36 μειώνει την έκφραση της λεπτίνης και έκκριση και αυξάνει την πρόσληψη γλυκόζης

Αδιπονενικής ανθρώπινου αδενοϊού 36 μειώνει την έκφραση της λεπτίνης και έκκριση και αυξάνει την πρόσληψη γλυκόζης από τα λιποκύτταρα

S D Vangipuram1, Μ Yu1, J Tian1, K L Stanhope2, Μ Pasarica1,3, P J Havel2, Α Ε Heydari1 και Ν V Dhurandhar3Received 22 Δεκεμβρίου 2005? Αναθεωρημένο 23ης Μαρτίου 2006? Αποδεκτές 24 Μάρ 2006? Που δημοσιεύθηκε online 16 Μαΐου του 2006.

Αρχή pageAbstractObjective: Ανθρώπινα αδενοϊό Ad 36 αιτίες παχυσαρκία σε ζωικά μοντέλα και ενισχύει τη συσσώρευση διαφοροποίησης και των λιπιδίων σε ανθρώπινο και 3Τ3 L1 προλιποκύτταρα, το οποίο μπορεί, εν μέρει, να εξηγήσει την αδιπογονική επίδραση της διαφήμισης 36. Εμείς καθορίζεται τις συνέπειες της διαφήμισης 36 λοίμωξης σε λεπτίνης και του μεταβολισμού της γλυκόζης στα κύτταρα λίπους.

Σχεδιασμός: 3Τ3 L1 προλιποκύτταρα χρησιμοποιήθηκαν για να προσδιοριστεί η επίδραση της μόλυνσης από ανθρώπινους αδενοϊούς Ad 36, Ad 2, Ad 9 και Ad 37 στην έκκριση λεπτίνης και συσσώρευση λιπιδίων. Αρουραίου πρωτογενή λιποκύτταρα χρησιμοποιήθηκαν για να προσδιοριστεί η επίδραση της διαφήμισης 36 μόλυνση στην έκκριση λεπτίνης και πρόσληψη γλυκόζης in vitro. Επιπλέον, η επίδραση της διαφήμισης 36 σχετικά με τις εκφράσεις της λεπτίνης και επιλεγμένα γονίδια από de novo λιπογένεσης μονοπάτι του σπλαχνικού λιπώδους ιστού συγκρίθηκαν ex vivo, μεταξύ Ad 36 μολυνθέντων και μη μολυνθέντων αρουραίους ελέγχου.

Αποτελέσματα: Ad 36 κατέστειλε την έκφραση του mRNA της λεπτίνης σε κύτταρα 3Τ3 L1 κατά περίπου 58 και 52% τις ημέρες 3 και 5 μετά την μόλυνση, αντίστοιχα. απελευθέρωσης λεπτίνης κανονικοποίηση ως προς την περιεκτικότητα σε κυτταρικό λιπιδίων ήταν 51% χαμηλότερη (PPM ινσουλίνη (ρρηι σε ινσουλίνη, αντίστοιχα. Στη συνέχεια, ο λιπώδης ιστός του Ad 36 μολυσμένα ποντίκια έδειξαν δύο έως πενταπλάσια χαμηλότερη έκφραση του mRNA της λεπτίνης, και 1,6 έως 21 φορές μεγαλύτερη εκφράσεις για ακετυλο Co A καρβοξυλάση 1 και 1,2 έως 6,3 φορές μεγαλύτερη εκφράσεις για συνθάσης λιπαρών οξέων, βασικά γονίδια de novo λιπογένεσης, σε σύAdidas σωληνοειδή σκιά δεμένη Unisex γκρι καταστηματαση με το μη μολυσμένο βάρος και παχυσαρκία μάρτυρες.

Συμπέρασμα: Η in vitro και ex vivo μελέτες δείχνουν ότι η διαφήμισή 36 ρυθμίζει τη διαφοροποίηση των λιποκυττάρων, η παραγωγή λεπτίνης και του μεταβολισμού της γλυκόζης. Εκτός από την γενετική, συμπεριφοράς, ενδοκρινικό και άλλοι παράγοντες, έχουν ιογενείς λοιμώξεις έχουν προταθεί ως ένας από τους εννέα αιτιολογικών παραγόντων για obesity1 και πρόσφατα λαμβάνουν αυξανόμενες attention.2, 3 Μέχρι σήμερα, επτά παθογόνα έχουν αναφερθεί για την προώθηση λιπαρότητα σε ζωικά μοντέλα 0,4, 5 αδενοϊού τύπου 36 (Ad 36) είναι η πρώτη ανθρώπινη ιός αναφερθεί ότι προκαλούν παχυσαρκία μαζί με μια παράδοξη σχετική υπολιπιδαιμία σε πειραματικά μολυσμένα κοτόπουλα, ποντικούς και μη ανθρώπινα primates.6, 7, 8 και Αδ 36 αντισώματα συνδέονται με την παχυσαρκία και μειωμένα επίπεδα χοληστερόλης στο humans.9 ο επιπολασμός των Ad 36 αντισωμάτων ήταν 30% στους παχύσαρκους σε σύNike Air Max 98 844694-600 άνδρες κόκκινο γκρι λευκό καταστηματαση με 11% στα μη παχύσαρκα άτομα σε διαλογή, και οι θετικές υποκείμενα αντίσωμα είχε μεγαλύτερα βάρη σώματος, αλλά κάτω των λιπιδίων του ορού, τα ευρήματα είναι παρόμοια με αυτά που παρατηρήθηκαν σε η models.10 ζώων

Η απουσία φανερής υποθαλάμου βλαβών και μια θετική συσχέτιση της διαφήμισης ποσότητας 36 DNA στο λιπώδη ιστό με τη μάζα του εν λόγω αποθήκη λιπώδους σε Ad 36 μολυσμένα ζώα (αδημοσίευτες παρατηρήσεις, Dhurandhar et al.) πρότεινε άμεση επίδραση του ιού στο λιπώδη ιστό , σε αντίθεση με μία κεντρικά διαμεσολαβούμενη μηχανισμό δράσης. Πρόσφατα αναφέρθηκε ότι Ad 36 ενισχύει τη διαφοροποίηση των 3Τ3 L1, καθώς και τα ανθρώπινα προλιποκύτταρα, 11 το οποίο μπορεί, εν μέρει, να εξηγήσει την in vivo αδιπογονική επίδραση της διαφήμισης 36. Ad 36 μόλυνση αύξησε τον αριθμό των λιποκυττάρων, περιεκτικότητα σε λιπίδια και τη δραστηριότητα της γλυκερόλης 3 φωσφορικής γλυκόζης (G 3PDH), ένας δείκτης διαφοροποίησης συγκεκριμένο ένζυμο του adipocytes.11

Μετά την παρατήρηση του πρωτογενούς αποτελέσματος της διαφήμισης 36 σχετικά με τη διαδικασία διαφοροποίησης προλιποκύτταρα, προχωρήσαμε στη διερεύνηση λειτουργικές διαμορφώσεις στα μολυσμένα λιποκύτταρα. Παραγωγή και απελευθέρωση των Αδιποκυτοκίνες είναι μία από τις σημαντικές λειτουργίες των λιποκυττάρων. Η λεπτίνη, μια πρωτεΐνη που εμπλέκεται στην ρύθμιση του σωματικού βάρους, είναι ένα από τα πιο εκτεταμένα μελετηθεί adipocytokines.12, 13 Κατά τη διάρκεια της διαφοροποιήσεως των λιποκυττάρων, αυξάνει την έκφραση της λεπτίνης ταυτόχρονα με λιπίδιο σταγονιδίων accumulation.14 λεπτίνη φαίνεται να έχει παρακρινή αποτελέσματα ανάδραση σχετικά λιποκυττάρων metabolism.15, 16 η λεπτίνη διεγείρει τη λιπόλυση, αναστέλλει την έκφραση των γονιδίων της σύνθεσης λιπιδίων όπως συνθάση λιπαρού οξέος (FAS) και ρυθμίζει αυξητικά γονίδια λιποκυττάρων που εμπλέκονται στην λιπιδική oxidation.17, 18 φορέα αδενοϊού που επάγεται σε αρουραίους υπερλεπτιναιμία εξαντλεί fat.19 σώμα Αντιστρόφως, αδιπογονική παράγοντες όπως οι θειαζολινεδιόνες και το βαλπροϊκό οξύ μειώνουν λεπτίνης secretion.20, 21, 22 Επιπλέον, λιποκυττάρων επιλεκτική μείωση των υποδοχέων λεπτίνης οδηγεί σε παχυσαρκία σε ποντικούς, παρά το φυσιολογικό επίπεδο του υποθαλάμου υποδοχέων λεπτίνης και κανονική τροφή intake.16 Τα ευρήματα αυτά υποδηλώνουν αδιπογονική ρόλος του υπολεπτιναιμία. Ως εκ τούτου, υποθέσαμε ότι μία σχετική υπολεπτιναιμία παράγονται τοπικά σε λιπώδη ιστό μπορεί να δράσει μέσω αυτοκρινούς / παρακρινούς οδού και να συμβάλει στη μεγαλύτερη διαφοροποίηση προλιποκυττάρων, συσσώρευση λιπιδίων και τη σύνθεση των λιπαρών οξέων σε κύτταρα μολυσμένα με Ad 36.11 Επιπλέον, η λεπτίνη μειώνει την ευαισθησία στην ινσουλίνη και την πρόσληψη γλυκόζης σε λιποκύτταρα .23, 24 Ως εκ τούτου, υποθέσαμε περαιτέρω ότι η διαφήμισή 36 που προκαλείται σε σχέση με υπολεπτιναιμία θα πρέπει να συνοδεύεται από μια αύξηση στην πρόσληψη της γλυκόζης στα λιποκύτταρα.

Όπως περιγράφεται παρακάτω, μελετήθηκε η επίδραση της διαφήμισης 36 μόλυνση στην έκφραση και έκκριση της λεπτίνης από κύτταρα 3Τ3 L1 και διαλογή άλλων ανθρώπινων αδενοϊών για παρόμοια αποτελέσματα. Στη συνέχεια, προσδιορίζεται η επίδραση της διαφήμισης 36 στην έκκριση λεπτίνης και πρόσληψη γλυκόζης σε αρουραίους πρωτογενή λιποκύτταρα. Λαμβάνοντας υπόψη την πιθανή μετατροπή της γλυκόζης σε λιποκύτταρα σε λιπίδια, προσδιορίσαμε την επίδραση στην έκφραση της λεπτίνης και τα γονίδια της de novo λιπογένεσης στον λιπώδη ιστό του Ad 36 μολυσμένα ποντίκια.

Αρχή των μεθόδων pageResearch και proceduresMaterialsMedia: ελάχιστο απαραίτητο μέσο Eagle (ΜΕΜ) (Cat M 0643, Sigma Chemicals, St Louis, MO, USA) με μη απαραίτητα αμινοξέα, του Earle άλατα και L γλουταμίνη και 10% ορό εμβρύου βοός (FBS, GIBCO, Carlsbad, CA, USA) χρησιμοποιήθηκε για την ανάπτυξη κυττάρων Α549 και Media Dulbecco τροποποιημένο Eagle (ϋΜΕΜ) (Cat Μ 0643, Sigma Chemicals) με 10% ορό εμβρύου βοός (FBS) χρησιμοποιήθηκε για να αναπτυχθούν τα κύτταρα 3Τ3 L1.

Ιστοκαλλιέργεια: Κύτταρα Α549 (κύτταρα ανθρώπινου καρκινώματος των βρόγχων) (ATCC Cat CCL 185) χρησιμοποιήθηκαν για αδενοϊούς συγκομιδή και τα κύτταρα 3Τ3 L1 (ATCC, CCL 92 Cat 1) χρησιμοποιήθηκαν για τα πειράματα διαφοροποίησης.

Ιών: Ad 36 που λαμβάνεται από την ATCC (Cat VR 913) και την πλάκα καθαρισμένη, χρησιμοποιήθηκε για τα πειράματα. Ο τίτλος των αποθεμάτων ιού προσδιορίστηκε όπως περιγράφεται previously.6

ExperimentsExperiment έκφραση γονιδίου 1. Λεπτίνη: (α) του Ad 36 εμβολιασμό και την διαφοροποίηση των κυττάρων 3Τ3 L1: κύτταρα 3Τ3 L1 αναπτύχθηκαν σε έξι φρεατίων (35 mm) και καλλιεργήθηκαν σε ϋΜΕΜ συμπληρωμένο με 10% ορό εμβρύου βοός (FBS) και 1 % αντιβιοτικό (Πενικιλλίνη Στρεπτομυκίνη και Αμφοτερικίνη Β). Στη συρροή (ημέρα 0), το μέσο απομακρύνθηκε από κάθε φρεάτιο και τα κύτταρα εμβολιάστηκαν με Ad 36 (Ad 36 ομάδα) (πολλαπλότητα μόλυνσης, ΜΟΙ 3.8) ή μέσο (ομάδα ελέγχου) και επωάστηκε για 1 ώρα στους 37 Ακολούθως, Αυτό το εμβόλιο αντικαταστάθηκε με 3 ml μέσου διαφοροποίησης (MDI, Nike Air Max 98 844694-600 άνδρες κόκκινο γκρι λευκό καταστηματα που περιέχει ϋΜΕΜ, και 10% βόειο ορό με 1 αντιβιοτικό 10 g / ml ινσουλίνη, 39 μg / ml δεξαμεθαζόνης και 115 g / ml 3 ισοβουτυλο 1 μεθυλξανθίνης). Μετά από επώαση για 48 ώρες στους 37 (ημέρα 2), το μέσο διαφοροποίησης αντικαταστάθηκε με 10% FBS ϋΜΕΜ που περιέχει 0,001% ινσουλίνη (media συντήρησης). μέσων συντήρησης αντικαταστάθηκε κάθε 2 ημέρες.

(β) εκχύλιση RNA: RNA εξήχθη από τον έλεγχο και Ad 36 εμβολιασμένα κύτταρα 3Τ3 L1 τις ημέρες 0, 1, 2, 3 και 5 μετά τον ενοφθαλμισμό αντιδραστηρίου με τη χρήση TRIZOL (Sigma cat Τ 9424), ακολουθούμενη από κατεργασία χλωροφόρμιο και κατακρήμνιση RNA με ισοπροπυλική αλκοόλ. Υπολειμματική γονιδιωματικό DNA απομακρύνθηκε χρησιμοποιώντας RNase ελεύθερη ϋΝάσης (Ambion, Austin, ΤΧ, USA). Οι συγκεντρώσεις RNA δείγματος και η καθαρότητα προσδιορίστηκαν με φασματοφωτομετρία. Η ακεραιότητα όλων των δειγμάτων RNA επιβεβαιώθηκε με ηλεκτροφόρηση σε πηκτώματα μετουσίωσης φορμαλδεύδης περιέχουν. Αυτό το RNA χρησιμοποιήθηκε για να προσδιοριστεί το επίπεδο του mRNA της λεπτίνης από ποιοτική RT PCR και PCR δοκιμασίες σε πραγματικό χρόνο, όπως περιγράφεται παρακάτω (γ και δ). Ξεχωριστές πειράματα διεξήχθησαν για να παράσχουν δείγματα για τις ποιοτικές και ποσοτικές δοκιμασίες RT PCR. RNA (1 g) δείγμα χρησιμοποιήθηκε για κάθε αντίδραση. φάσμα γραμμικότητα των αριθμών κύκλο PCR αποφασίστηκε από δοκιμή γραμμικότητας. Οι ακόλουθες συνθήκες χρόνου και θερμοκρασίας χρησιμοποιήθηκαν για τη δοκιμασία: Αντίστροφη μεταγραφή: 1 ώρα, 50 PCR: μετουσίωση 30 s στους 94 ° C ανόπτηση 30 s στους 65 προέκταση 1 λεπτό στους 68 και τελική επέκταση 2 λεπτά στους 68 Αδρανοποιημένος ανάστροφης μεταγραφάσης (με θέρμανση για 5 λεπτά στους 95 χρησιμοποιήθηκε σαν ένας αρνητικός έλεγχος για κάθε δείγμα και 18 s rRNA έκφραση χρησιμοποιήθηκε ως θετικός έλεγχος για την δοκιμασία. έκφραση του γονιδίου λεπτίνη ποσοτικοποιήθηκε χρησιμοποιώντας Bio Rad Chemi εικονοληψίας (Cat 170 8060) και ομαλοποιήθηκε ως προς την έκφραση 18sRNA.

(δ) γονίδιο λεπτίνης έκφρασης με πραγματικού χρόνου RT PCR: ολικού RNA 1 g μεταγράφηκε ανάστροφα σε cDNA χρησιμοποιώντας iScriptTM cDNA Synthesis Kit (Cat 170 8890, Βίο Rad, Hercules, CA, USA) σύμφωνα με το πρωτόκολλο του κατασκευαστή. Τρία όμοια δείγματα (που λαμβάνονται από πειράματα επαναλαμβάνονται τρεις φορές) χρησιμοποιήθηκαν για τον έλεγχο και Ad 36 ομάδες. Οι αντιδράσεις 20 l επωάστηκαν στους 25 ° C για 5 λεπτά, στη συνέχεια στους 42 για 30 λεπτά που ακολουθείται από 85 για 5 λεπτά, για να απενεργοποιηθεί η αντίστροφη μεταγραφάση. Η ποσότητα του mRNA της λεπτίνης σε σχέση με την ακτίνη ενδογενούς ελέγχου προσδιορίστηκε χρησιμοποιώντας πραγματικού χρόνου, ποσοτική PCR. Η αλληλουχία των εκκινητών λεπτίνης ήταν 5 ‘GAATGCTGAAGTTTCAAAGG 3′, προς τα εμπρός εναρκτήρα και 5 ‘GGAGAGAAATGAATGATGGA 3′ αντίστροφο έναυσμα της ακολουθίας cDNA γονίδιο λεπτίνη. Τα αναμενόμενα μεγέθη των προϊόντων για τους εκκινητές ακτίνης και της λεπτίνης ήταν 143 και 121 bp, αντίστοιχα. Πραγματικού χρόνου ποσοτική PCR πραγματοποιήθηκε στο σύστημα iQ iCycler (Bio Rad) χρησιμοποιώντας Syber Πράσινο σύστημα ανίχνευσης (Cat 170 8880, Βίο Rad).

Εν συντομία, σε 2,5 λίτρα του πράσινου ρυθμιστικού 10 SYBR, 1 mM dA, dG, dC και dUTP, 2 mM MgCl2, 0,625 υ iTaq DNA πολυμεράση, 250 nm του προς τα εμπρός και αντίστροφο εκκινητή, 5 l από 1:10 αραίωση του cDNA, προστέθηκε νερό για να κάνει 25 λίτρα. Οι αντιδράσεις πραγματοποιήθηκαν στην PCR πλάκα 96 φρεατίων καλυμμένο με οπτική ποιότητα μονωτική ταινία. Το νερό χρησιμοποιήθηκε ως αρνητικός έλεγχος. Η ποσότητα της λεπτίνης mRNA σε σχέση με ακτίνη υπολογίστηκε ως 2 Ct όπου Ct = CtleptinS CtActin. Ως σχετική έκφραση του γονιδίου της λεπτίνης σε Ad 36 μολυνθέντων και μη μολυνθέντων έλεγχοι ήταν υπό μελέτη και αφού τα γονίδια ενισχύονται με τον ίδιο ρυθμό, κανένα πρότυπο χρησιμοποιήθηκε για την απόλυτη ποσοτικοποίηση.

Πείραμα 2. Η λεπτίνη απελευθέρωσης με 3Τ3 L1 κυττάρων (α) μέτρηση λεπτίνη: Διαφοροποίηση των συρρεόντων 3Τ3 L1 προλιποκύτταρα (6 φρεάτια / ομάδα) προκλήθηκε με MDI μετά τον εμβολιασμό τους με Ad 36 ή μέσων (ελέγχου) όπως περιγράφεται παραπάνω. Την ημέρα 5 μετά τον εμβολιασμό, το υπερκείμενο των μέσων ενημέρωσης από όλα τα φρεάτια απομακρύνθηκε και αραιώθηκε 1: 2 με ρυθμιστικό δοκιμασίας που παρέχονται με το κιτ (κιτ Titerzyme ΕΙΑ ποντίκι λεπτίνη ELISA, Assay Designs Inc, Cat 900 019). Τα επίπεδα λεπτίνης στα μέσα προσδιορίστηκαν την 5η ημέρα με επώαση των αραιώνεται μέσα με αντίσωμα λεπτίνη ποντικού επικαλυμμένα σε πλάκες 96 φρεατίων για 1 ώρα στους 37 τα φρέατα πλύθηκαν επιμελώς με ρυθμιστικό διάλυμα πλύσης και λεπτίνης σύNike Air Max 2016 806772-400 γυναίκες μπλε Greece Online Shopγμα πρωτογενούς αντισώματος επωάστηκε με δευτερογενές αντίσωμα ( IgG κουνελιού συνδεδεμένο με υπεροξειδάση αρμορακίας ένζυμο) για 30 λεπτά στους 37 Μετά από διεξοδική πλύση, όλα τα φρεάτια επωάστηκαν με διάλυμα υποστρώματος (τετραμεθυλ βενζιδίνη) για τη ραφανιδική υπεροξειδάση και επωάστηκαν για 30 λεπτά σε θερμοκρασία δωματίου στο σκοτάδι. Η οπτική πυκνότητα μετρήθηκε στα 450 nm σε έναν αναγνώστη μικρο πλάκας. Η πρότυπη καμπύλη κατασκευάστηκε χρησιμοποιώντας το πρότυπο λεπτίνης που παρέχονται στο κιτ. έκλυση λεπτίνης στα μέσα μαζικής ενημέρωσης κανονικοποιήθηκε με την περιεκτικότητα λιπιδίων του πηγάδι, το οποίο προσδιορίστηκε ως εξής.

(β) Προσδιορισμός της κυτταρικής περιεκτικότητας σε λιπίδια: Οίΐ Red Ο, ένα ειδικό λιπίδιο βαφή λεκέδες λιποκύτταρα ανάλογα με τις συσσωρευμένες λιπίδια και τη δοκιμασία χρησιμοποιείται ευρέως για τον προσδιορισμό κυτταρικής content.25 λιπιδίων Μετά την απομάκρυνση των μέσων ενημέρωσης για τον προσδιορισμό λεπτίνης όπως περιγράφεται ανωτέρω, τα κύτταρα σταθεροποιήθηκαν για 1 ώρα με 10% φορμαλίνη, κατόπιν πλύθηκε με νερό και χρωματίζονται για 2 ώρες με Oil Red ο, ακολουθούμενη από εξαντλητική έκπλυση με νερό. Μετά την εξάτμιση της περίσσειας του νερού στους 32 η χρωστική εκχυλίστηκε με ισοπροπυλική αλκοόλη και η απορρόφηση του προσδιορίστηκε στα 510 nm, η οποία κανονικοποιήθηκε με το ποσό της κυτταρικής DNA στο δείγμα. Το κυτταρικό DNA του κάθε φρεάτιο προσδιορίστηκε χρησιμοποιώντας το κιτ Οδηγό Γονιδιωματικό DNA καθαρισμός (Promega, Cat Α 1620).

Πείραμα 3: Επίδραση των άλλων ανθρώπινων αδενοϊούς για τη διαφοροποίηση και την έκκριση λεπτίνης από 3Τ3 L1 cellsWe καθοριστεί εάν η επίδραση της διαφήμισης 36 για τη διαφοροποίηση και την έκκριση λεπτίνης από κύτταρα 3Τ3 L1 ήταν κοινό σε άλλες αδενοϊούς υποομάδας Α, όπως Ad 37 και Ad 9. Λαμβάνοντας υπόψη το γεγονός ότι η διαφήμισή 2, ένα αδενοϊό υποομάδας C δεν προκαλεί προ-λιποκυττάρων differentiation11 χρησιμοποιήθηκε ως αρνητικός μάρτυρας, ενώ Ad 36 χρησιμοποιήθηκε ως θετικός μάρτυρας. κύτταρα l1 Συρρέοντα 3Τ3 εμβολιάζονται είτε με τα μέσα ενημέρωσης (έλεγχος), Ad 36 (ΜΟΙ 3.0), AD 9 (ΜΟΙ 1.0), Ad 37 (ΜΟΙ 30) ή Ad 2 (ΜΟΙ 2.5) και διαφοροποιημένα, όπως περιγράφεται στο πείραμα συσσώρευση 1. λιπιδίων σε προσδιορίστηκε με τη μέθοδο Oil Red Ο και λεπτίνης στα μέσα μετρήθηκε με λεπτίνη Titerzyme Ε1Α ποντίκι κιτ ELISA (Assay Design, cat 900 019), όπως περιγράφεται στο Πείραμα 2. συσσώρευση λιπιδίων ομαλοποιήθηκε ως προς την ποσότητα του DNA και της λεπτίνης ομαλοποιήθηκε να η ποσότητα λιπιδίων σε κάθε φρεάτιο.

Πείραμα 4 λεπτίνη απελευθέρωση από αρουραίο πρωτογενή λιποκύτταρα (α) την απομόνωση των λιποκυττάρων και του πολιτισμού Τα πρωτόκολλα των ζώων εγκρίθηκαν από τη Φροντίδα και Χρήση Διοικητικής Επιτροπής των ζώων στο Πανεπιστήμιο της Καλιφόρνια. Λιποκύτταρα ελήφθησαν από επιδιδυμικού λίπους μαξιλάρια αρσενικών αρουραίων Sprague (Harlan Sprague Dawley, Indianapolis, ΙΝ, USA) όπως described.26 προηγουμένως Μια σύντομη περιγραφή της διαδικασίας είναι ως ακολούθως.

απομόνωση των λιποκυττάρων και του πολιτισμού Λιποκύτταρα απομονώθηκαν από επιδιδυμίδας λίπος αποθήκες. Το λίπος κιμά με ψαλίδι σε ρυθμιστικό HEPES (ρΗ 7,4? Περιείχε 5 mM D γλυκόζη, 2% BSA, 135 mM NaCl, 2,2 mM CaCl22H2O, 1.25 mM MgSO47H2O, 0,45 mM ΚΗ2ΡΟ4, 2,17 mM Να2ΗΡΟ4 και 10 mM HEPES). Ο λιπώδης ιστός θραύσματα υπέστησαν πέψη στο ίδιο ρυθμιστικό διάλυμα με κολλαγενάση τύπου Ι (1,25 mg / ml ανά 0.5 g ιστού) σε 37 με ήπια ανακίνηση για 30 λεπτά. Το προκύπτον κυτταρικό εναιώρημα αραιώθηκε σε φωσφορικό ρυθμιστικό διάλυμα HEPES, και τα απομονωμένα λιποκύτταρα στη συνέχεια διαχωρίστηκαν από το άπεπτο ιστό με διήθηση μέσα από ένα πλέγμα νάιλον των 400 m και πλύθηκαν τρεις φορές. Απομονωμένα λιποκύτταρα στη συνέχεια εκ νέου σε εναιώρηση εντός DMEM συμπληρωμένο με 1% FBS και επωάστηκε για 40 λεπτά στους 37 Το απομονωμένο λιποκύτταρα (150 λίτρα αναλογία 2: 1 συσκευασμένων κυττάρων σε μέσο) τοποθετήθηκαν στη συνέχεια σε 500 λίτρα μήτρα κολλαγόνου (Vitrogen 100 , Τεχνολογίες Συνοχής) σε έξι τρυβλία καλλιέργειας καλά. Μετά από 50 λεπτά επώασης στους 37 ° C 2 ml ϋΜΕΜ συμπληρωμένο με 1% FBS προστέθηκε σε κάθε φρεάτιο.

τα έξι φρεάτια σε μία πλάκα καλλιέργειας σπάρθηκαν σε ίσες πυκνότητα με τα λιποκύτταρα που απομονώνονται από ένα ζώο και εμβολιάζεται με 4 105 PFU Ad 36, ή μέσα (n = 7 πλάκες ανά ομάδα). Μετά από 24 ώρες, το μέσο εμβολιασμού απομακρύνθηκε και αντικαταστάθηκε με 2 ml μέσου που δεν περιέχει ινσουλίνη ή φυσιολογική συγκέντρωση της ινσουλίνης (0,48 ή 1,6 ηΜ). Μέσα σε κάθε πλάκα, υπήρχαν λιποκύτταρα αντιμετωπίζονται χωρίς ινσουλίνη, με ινσουλίνη, με Ad 36, και με Ad 36 και ινσουλίνης. Τα κύτταρα διατηρήθηκαν μέσα σε έναν επωαστήρα στους 37 ° C σε 5% CO2 για μέχρι και 96 ώρες. Δείγματα (300 λίτρα) του μέσου συλλέχθηκαν σε 24, 48, 72, και 96 ώρες και η ποσότητα του δείγματος αντικαταστάθηκε με φρέσκο ​​μέσο. Η πρόσληψη γλυκόζης, παραγωγή γαλακτικού, και λεπτίνης έκκριση προσδιορίστηκαν.


Похожие статьи
Комментарии к статье